lllin000_PaperForge/audit/28ALPCY7/block_trace.csv

1	page	block_id	raw_label	content_preview	bbox	role	role_confidence	evidence	seed_role	seed_confidence	zone	style_family	marker_type	render_default	index_default
2	1	0	header_image		[83.0, 75.0, 569.0, 174.0]	unknown_structural	0.2	["unrecognized label 'header_image'"]	unknown_structural	0.2	frontmatter_main_zone	support_like	empty	False	True
3	1	1	header_image		[815.0, 70.0, 1123.0, 142.0]	unknown_structural	0.2	["unrecognized label 'header_image'"]	unknown_structural	0.2	frontmatter_main_zone	support_like	empty	False	True
4	1	2	header	Subscriber access provided by University of Glasgow Library	[685.0, 195.0, 1120.0, 216.0]	noise	0.9	["header label"]	noise	0.9	frontmatter_main_zone	support_like	none	False	False
5	1	3	text	Tissue Engineering and Regenerative Medicine	[86.0, 219.0, 640.0, 251.0]	authors	0.8	["page-1 zone author_zone: Tissue Engineering and Regenerative Medicine"]	authors	0.8	frontmatter_main_zone	support_like	none	True	True
6	1	4	doc_title	3D-printed #- tricalcium phosphate scaffold combined with a pulse electromagnetic field promotes the repair of skull defects in rats	[134.0, 263.0, 1055.0, 328.0]	paper_title	0.8	["page-1 zone title_zone: 3D-printed #- tricalcium phosphate scaffold combined with a "]	paper_title	0.8	frontmatter_main_zone	support_like	none	True	True
7	1	5	text	Haifeng Liang, Xiao Liu, Ying Pi, Qiang Yu, Yukun Yin, Xian Li, Yipei Yang, and Jing Tian	[153.0, 335.0, 1036.0, 364.0]	authors	0.8	["page-1 zone author_zone: Haifeng Liang, Xiao Liu, Ying Pi, Qiang Yu, Yukun Yin, Xian "]	authors	0.8	frontmatter_main_zone	support_like	none	True	True
8	1	6	text	ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.9b00858 • Publication Date (Web): 03 Sep 2019	[308.0, 369.0, 874.0, 414.0]	frontmatter_noise	0.8	["page-1 zone journal_furniture_zone: ACS Biomater. Sci. Eng., Just Accepted Manuscript \u2022 DOI: 10."]	frontmatter_noise	0.8	frontmatter_main_zone	support_like	none	False	False
9	1	7	text	Downloaded from pubs.acs.org on September 3, 2019	[361.0, 420.0, 831.0, 445.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	frontmatter_main_zone	support_like	none	True	True
10	1	8	paragraph_title	Just Accepted	[124.0, 515.0, 281.0, 541.0]	frontmatter_noise	0.8	["page-1 zone journal_furniture_zone: Just Accepted"]	frontmatter_noise	0.8	frontmatter_main_zone	heading_like	short_fragment	False	False
11	1	9	abstract	“Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemic	[132.0, 564.0, 1058.0, 883.0]	unknown_structural	0.85	["abstract label from Paddle OCR"]	abstract_body	0.85	frontmatter_main_zone	support_like	none	False	True
12	1	10	footer	is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036	[591.0, 1562.0, 1071.0, 1595.0]	noise	0.9	["footer label"]	noise	0.9	frontmatter_main_zone	support_like	none	False	False
13	1	11	footer	Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth	[590.0, 1597.0, 1113.0, 1665.0]	noise	0.9	["footer label"]	noise	0.9	frontmatter_main_zone	support_like	none	False	False
14	2	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[8.0, 90.0, 44.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	frontmatter_main_zone	reference_like	reference_numeric_dot	False	False
15	2	1	number	Page 1 of 36	[12.0, 18.0, 122.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	frontmatter_side_zone	support_like	short_fragment	False	False
16	2	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	frontmatter_side_zone	support_like	none	False	False
17	2	3	doc_title	3D-printed $ \beta $-tricalcium phosphate scaffold combined with a pulse electromagnetic field promotes the repair of skull defects in rats	[191.0, 182.0, 1000.0, 344.0]	unknown_structural	0.8	["page-1 zone title_zone: 3D-printed $ \\beta $-tricalcium phosphate scaffold combined"]	paper_title	0.8	body_zone	body_like	none	False	True
18	2	4	text	Haifeng Liang $ ^{a} $, Xiao Liu $ ^{b} $, Ying Pi $ ^{a} $, Qiang Yu $ ^{a} $, Yukun Yin $ ^{a} $, Xian Li $ ^{a} $, Yipei Yang $ ^{a} $, Jing Tian $ ^{*a} $	[174.0, 380.0, 946.0, 408.0]	unknown_structural	0.8	["page-1 zone author_zone: Haifeng Liang $ ^{a} $, Xiao Liu $ ^{b} $, Ying Pi $ ^{a} $,"]	authors	0.8	body_zone	body_like	none	False	True
19	2	5	text	a Department of Orthopedics, Zhujiang Hospital, Southern Medical University, No. 253 Industrial Avenue, Haizhu, Guangzhou 510280, People's Republic of China	[174.0, 443.0, 1015.0, 533.0]	affiliation	0.8	["page-1 zone affiliation_zone: a Department of Orthopedics, Zhujiang Hospital, Southern Med"]	affiliation	0.8	body_zone	body_like	none	True	True
20	2	6	text	$ ^{b} $ School of Materials Science and Engineering, South China University of Technology, Wushan, Guangzhou 510640, People's Republic of China	[173.0, 568.0, 1015.0, 657.0]	affiliation	0.8	["page-1 zone affiliation_zone: $ ^{b} $ School of Materials Science and Engineering, South "]	affiliation	0.8	body_zone	body_like	affiliation_marker	True	True
21	2	7	text	*Corresponding author: Jing Tian, Email: tianjing_ortho@163.com	[176.0, 693.0, 748.0, 720.0]	frontmatter_support	0.78	["first-surviving-page support text: *Corresponding author: Jing Tian, Email: tianjing_ortho@163."]	frontmatter_support	0.78	frontmatter_side_zone	support_like	none	True	True
22	2	8	paragraph_title	ABSTRACT	[175.0, 815.0, 277.0, 842.0]	abstract_heading	0.95	["abstract heading"]	abstract_heading	0.95	frontmatter_side_zone	heading_like	short_fragment	True	True
23	2	9	abstract	Trauma, infection, cancer and congenital diseases can lead to bone defects. The combination of 3D printing with biomaterials is of great significance in the treatment of bone defects. In addition, pul	[174.0, 880.0, 1017.0, 1533.0]	abstract_body	0.85	["abstract label from Paddle OCR"]	abstract_body	0.85	body_zone	body_like	none	True	True
24	2	10	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
25	3	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 85.0, 42.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
26	3	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
27	3	2	number	Page 2 of 36	[1069.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
28	3	3	text	proliferation and differentiation of rADSCs and the repair of a critical defect in the rat skull. Therefore, the combination of $ \beta $-TCP and PEMF with 3D printing technology can provide better t	[175.0, 164.0, 1015.0, 316.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
29	3	4	text	KEYWORDS: 3D printing; $ \beta $-tricalcium phosphate; pulse electromagnetic field; bone defect	[175.0, 476.0, 953.0, 502.0]	structured_insert	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	False	False
30	3	5	paragraph_title	INTRODUCTION	[176.0, 664.0, 311.0, 687.0]	section_heading	0.9	["explicit scholarly heading: INTRODUCTION"]	section_heading	0.9	body_zone	heading_like	canonical_section_name	True	True
31	3	6	text	Pulse electromagnetic fields (PEMFs) are transient electromagnetic fields produced in a coil when a pulse current generated by a pulse generator passes through the coil. The strength and frequency of	[173.0, 726.0, 1017.0, 1503.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
32	3	7	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
33	4	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 90.0, 44.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
34	4	1	number	Page 3 of 36	[12.0, 18.0, 121.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
35	4	2	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 46.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
36	4	3	text	PEMFs have a "window effect" $ ^{39} $; that is, the field strength, frequency and action time of PEMFs do not have linear relationships with the biological effects observed in cells. The field streng	[171.0, 162.0, 1019.0, 1504.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
37	4	4	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
38	5	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 84.0, 42.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
39	5	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
40	5	2	number	Page 4 of 36	[1069.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
41	5	3	text	nonunion and other orthopedic diseases, it is rarely used to treat bone defects. Prior to this study, we demonstrated that PEMF therapy (50 Hz, 1 mT) can promote the proliferation and osteogenic diffe	[174.0, 166.0, 1017.0, 441.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
42	5	4	text	The treatment of bone defects has always been a clinical problem, and the gold standard for treatment is autografts. However, bone transplantation has disadvantages such as few available sources, a la	[173.0, 476.0, 1017.0, 1504.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
43	5	5	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
44	6	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[10.0, 90.0, 42.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
45	6	1	number	Page 5 of 36	[13.0, 18.0, 121.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
46	6	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 763.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
47	6	3	text	also contains a porous structure design and rapid prototyping technology to provide space for osteoblast growth and vascular formation and to shorten the whole transplantation process. The combination	[175.0, 166.0, 1016.0, 380.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
48	6	4	paragraph_title	MATERIALS AND METHODS	[176.0, 539.0, 423.0, 562.0]	section_heading	0.9	["explicit scholarly heading: MATERIALS AND METHODS"]	section_heading	0.9	body_zone	heading_like	canonical_section_name	True	True
49	6	5	paragraph_title	Fabrication and characterization of $ \beta $-TCP scaffolds	[176.0, 601.0, 626.0, 625.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: Fabrication and characterization of $ \\beta $-TCP scaffolds"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
50	6	6	text	The β-TCP scaffolds were fabricated as previously described $ ^{33} $. Briefly, β-TCP powder was prepared using the chemical precipitation method. Then, ammonium polyacrylate (PAA-NH4) and hydroxyprop	[174.0, 663.0, 1016.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
51	6	7	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
52	7	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[10.0, 85.0, 41.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
53	7	1	header	ACS Biomaterials Science & Engineering	[425.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
54	7	2	number	Page 6 of 36	[1069.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
55	7	3	text	volume of the $ \beta $-TCP scaffolds was reduced to 90% after sintering. The design of the scaffold was completed by the CAD software SolidWorks (Massachusetts, USA). The scaffold was coated with go	[174.0, 164.0, 1015.0, 317.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
56	7	4	paragraph_title	Cell culture and PEMF treatment	[176.0, 352.0, 470.0, 376.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: Cell culture and PEMF treatment"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
57	7	5	text	ADSCs were obtained from the groin of 3-day-old Sprague Dawley rats. The cells were cultured on Dulbecco's minimum Eagle's medium (DMEM, Gibco) with 10% fetal bovine serum (FBS, Gibco) and 5% antibiot	[174.0, 415.0, 1016.0, 628.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
58	7	6	text	The prepared cells were randomly divided into four groups and seeded on tissue culture plates (TCPS) or $ \beta $-TCP scaffolds. The LIVE/DEAD Cell Staining Kit (BioVision, Inc.) was applied to rADSC	[173.0, 665.0, 1016.0, 940.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
59	7	7	text	The PEMF device (Yongyikeji, Hunan, China) consisted of a generator and its connected coils. When the generator produces a pulse current of a certain intensity, a PEMF will be generated between the co	[173.0, 977.0, 1016.0, 1377.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
60	7	8	paragraph_title	CCK-8 and LIVE/DEAD cell staining	[176.0, 1475.0, 480.0, 1499.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: CCK-8 and LIVE/DEAD cell staining"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
61	7	9	footer	ACS Paragon Plus Environment	[463.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
62	8	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 91.0, 44.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
63	8	1	number	Page 7 of 36	[13.0, 18.0, 121.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
64	8	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
65	8	3	text	The CCK-8 assay was performed to evaluate the proliferation of ADSCs under the influence of PEMF and the scaffolds. rADSCs were cultured in basic culture medium for 1, 4 or 7 days on TCPS and $ \beta	[173.0, 165.0, 1016.0, 563.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
66	8	4	text	LIVE/DEAD cell staining was performed to evaluate the cytotoxicity of the $ \beta $-TCP scaffolds. Each scaffold was washed twice with PBS after 24, 48 and 72 hours, before the working solution was a	[174.0, 601.0, 1016.0, 878.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
67	8	5	paragraph_title	ALP activity and osteogenesis - related gene expression	[175.0, 913.0, 661.0, 938.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: ALP activity and osteogenesis - related gene expression"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
68	8	6	text	To evaluate the osteogenic differentiation of ADSCs, cellular ALP activity was accessed with an alkaline phosphatase assay kit (A059-1, Nanjing Jiancheng Bioengineering Institute, China) after 7 or 14	[174.0, 978.0, 1017.0, 1503.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
69	8	7	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
70	9	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 86.0, 42.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
71	9	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
72	9	2	number	Page 8 of 36	[1069.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
73	9	3	text	was completed with the cALP Stain Kit (D001-1-1, Nanjing Jiancheng Bioengineering Institute, China).	[174.0, 164.0, 1015.0, 254.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
74	9	4	text	The expression of osteogenesis-related genes in the four groups was evaluated by SYBR Green Real-Time PCR (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA of the ADSCs of the four groups was is	[173.0, 289.0, 1017.0, 818.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
75	9	5	figure_title	Table 1. Primer sequences used for qRT-PCR.	[197.0, 851.0, 587.0, 877.0]	table_caption	0.9	["table prefix matched: Table 1. Primer sequences used for qRT-PCR."]	table_caption	0.9	display_zone	table_caption_like	table_number	True	True
76	9	6	table	<table><tr><td>Gene</td><td>Forward(5′-3′)</td><td>Reverse(5′-3′)</td></tr><tr><td>ALP</td><td>ACCATTCCCACGTCTTCACATTT</td><td>AGACATTCTCTCGTTCACCGCC</td></tr><tr><td>RUNX2</td><td>ACTTCCTGTGCTCGGTGCT	[204.0, 911.0, 979.0, 1110.0]	table_html	0.85	["media label: table"]	media_asset	0.85	body_zone	unknown_like	none	True	True
77	9	7	paragraph_title	Surgical operation and PEMF treatment	[175.0, 1163.0, 529.0, 1188.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: Surgical operation and PEMF treatment"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
78	9	8	text	All the surgical operations were approved by the Ethics Committee of Southern Medical University. Eighteen female Sprague-Dawley rats (180-200 g) were anesthetized with chloral hydrate (300 mg/kg body	[173.0, 1225.0, 1017.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
79	9	9	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
80	10	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 89.0, 42.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
81	10	1	number	Page 9 of 36	[13.0, 18.0, 121.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
82	10	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
83	10	3	text	mm, on both sides of the parietal bone; physiological saline was added dropwise to help reduce the increase in temperature from the drill. A size matched scaffold, with a diameter of 4.8 mm and a heig	[173.0, 166.0, 1017.0, 441.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
84	10	4	text	On the third day after the operation, the 18 SD rats were randomly divided into 2 groups. One group was treated with PEMF (50 Hz, 1 mT, 2 hours per day), and the other group, as a control, did not rec	[173.0, 476.0, 1017.0, 877.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
85	10	5	paragraph_title	Micro-CT	[175.0, 912.0, 264.0, 936.0]	sub_subsection_heading	0.6	["unnumbered paragraph_title, inferred level sub_subsection_heading: Micro-CT"]	sub_subsection_heading	0.6	body_zone	heading_like	short_fragment	True	True
86	10	6	text	The skulls were placed into an X-ray CT scanner for experimental animals (Latheta LCT-200) and scanned with a resolution of 18 $ \mu $m. DICOM images were obtained. Bone mineral density was analyzed	[173.0, 975.0, 1017.0, 1249.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
87	10	7	paragraph_title	Histological examination	[176.0, 1288.0, 400.0, 1313.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: Histological examination"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
88	10	8	text	The free skulls were fixed with formalin for 24 hours and then decalcified with EDTA decalcifying solution (Solarbio, China) for 14 days. The decalcified samples were dehydrated by gradient alcohol an	[173.0, 1349.0, 1017.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
89	10	9	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
90	11	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59	[11.0, 89.0, 41.0, 1517.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
91	11	1	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
92	11	2	number	Page 10 of 36	[1060.0, 18.0, 1178.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
93	11	3	text	tissue sections. Hematoxylin-eosin staining of the sections was used to stain the nucleus blue and the cytoplasm red.	[174.0, 164.0, 1014.0, 253.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
94	11	4	paragraph_title	Statistics	[176.0, 289.0, 262.0, 312.0]	sub_subsection_heading	0.6	["unnumbered paragraph_title, inferred level sub_subsection_heading: Statistics"]	sub_subsection_heading	0.6	body_zone	heading_like	short_fragment	True	True
95	11	5	text	The statistical analyses of this study were completed with SPSS software (Version 20.0). All biological experiments in this study were repeated at least three times. The data were analyzed by one-way	[174.0, 352.0, 1015.0, 568.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
96	11	6	paragraph_title	RESULTS AND DISCUSSION	[176.0, 725.0, 415.0, 749.0]	section_heading	0.9	["explicit scholarly heading: RESULTS AND DISCUSSION"]	section_heading	0.9	body_zone	heading_like	canonical_section_name	True	True
97	11	7	paragraph_title	β-TCP scaffold characterization	[176.0, 788.0, 454.0, 812.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: \u03b2-TCP scaffold characterization"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
98	11	8	text	The surface morphology of the fritted β-TCP scaffolds was observed by SEM (Figure 1a and 1b.), which showed that the structure of the scaffolds was arranged regularly with a bar that was 170±10 μm in	[173.0, 851.0, 1017.0, 1252.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
99	11	9	text	The $ \beta $-TCP scaffolds produced by 3D printing technology had great porosity. This property can provide a large number of adhesion areas for cells. When used as a graft, high porosity scaffolds	[174.0, 1289.0, 1015.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
100	11	10	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
101	12	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 92.0, 42.0, 1517.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
102	12	1	number	Page 11 of 36	[12.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
103	12	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
104	12	3	vision_footnote	beneficial for osteogenesis and angiogenesis.	[177.0, 163.0, 566.0, 189.0]	footnote	0.7	["vision_footnote label: beneficial for osteogenesis and angiogenesis."]	footnote	0.7	body_zone	body_like	none	True	True
105	12	4	image		[178.0, 206.0, 588.0, 560.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
106	12	5	image		[598.0, 206.0, 1011.0, 559.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
107	12	6	image		[179.0, 574.0, 590.0, 922.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
108	12	7	image		[599.0, 570.0, 1010.0, 922.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
109	12	8	figure_title	Figure 1. SEM images of 3D-printed β-TCP scaffolds: the top panels are (a) 100×, (b) 240× and show that the diameter of the bar is approximately 170±10 microns. The bars are arranged vertically, which	[173.0, 943.0, 1016.0, 1159.0]	figure_caption	0.92	["figure_title label: Figure 1. SEM images of 3D-printed \u03b2-TCP scaffolds: the top "]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
110	12	9	paragraph_title	LIVE/DEAD staining	[175.0, 1256.0, 354.0, 1283.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: LIVE/DEAD staining"]	subsection_heading	0.6	body_zone	heading_like	short_fragment	True	True
111	12	10	text	To determine the cytocompatibility and cytotoxicity of the scaffolds, we performed the LIVE/DEAD cell staining assay. As the results show (Figure 2.), living cells were dyed green, and dead cells were	[173.0, 1319.0, 1017.0, 1534.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
112	12	11	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
113	13	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 84.0, 41.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
114	13	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
115	13	2	number	Page 12 of 36	[1059.0, 18.0, 1178.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
116	13	3	text	morphology of the rADSCs attached to the scaffold was observed. The ratios of live/dead rADSCs at 24, 48 and 72 hours were 4.36 (Figure 2a, 109/25), 5.81 (Figure 2b, 343/59) and 7.60 (Figure 2c, 251/3	[172.0, 164.0, 1017.0, 441.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
117	13	4	image		[244.0, 463.0, 624.0, 733.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
118	13	5	image		[635.0, 464.0, 1011.0, 732.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
119	13	6	image		[188.0, 742.0, 625.0, 1011.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
120	13	7	image		[633.0, 744.0, 1012.0, 1012.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
121	13	8	image		[244.0, 1022.0, 624.0, 1291.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
122	13	9	image		[634.0, 1023.0, 1011.0, 1291.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
123	13	10	figure_title	Figure 2. LIVE/DEAD staining of rADSCs cultured on scaffolds in ordinary medium for 24, 48 or 72 hours. Live cells are stained green and dead cells are stained red. In the low power field of vision, t	[173.0, 1318.0, 1019.0, 1533.0]	figure_caption	0.92	["figure_title label: Figure 2. LIVE/DEAD staining of rADSCs cultured on scaffolds"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
124	13	11	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
125	14	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59	[9.0, 95.0, 42.0, 1515.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
126	14	1	number	Page 13 of 36	[12.0, 18.0, 130.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
127	14	2	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
128	14	3	text	of culture time. In the high-power field of vision, the living cells exhibit a state of expansion in the early stage (b) and elongation in the later stage (f).	[173.0, 164.0, 1015.0, 254.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
129	14	4	paragraph_title	CCK-8 assay	[175.0, 351.0, 288.0, 378.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: CCK-8 assay"]	subsection_heading	0.6	body_zone	heading_like	short_fragment	True	True
130	14	5	text	As shown in Figure 3, after one day of culture, the proliferation rate of the rADSCs cultured on the scaffold was significantly higher than that of the cells cultured on TCPS, but PEMF treatment had n	[172.0, 415.0, 1018.0, 1317.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
131	14	6	footer	ACS Paragon Plus Environment	[463.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
132	15	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59	[9.0, 87.0, 42.0, 1514.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
133	15	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
134	15	2	number	Page 14 of 36	[1059.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
135	15	3	chart		[200.0, 182.0, 993.0, 583.0]	figure_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
136	15	4	figure_title	Figure 3. CCK-8 analysis after culture for 1, 4, or 7 days on TCPS or $ \beta $-TCP scaffolds. After 1 day of culture, the proliferation rate of rADSCs cultured on $ \beta $-TCP scaffolds was signif	[172.0, 631.0, 1016.0, 1037.0]	figure_caption	0.92	["figure_title label: Figure 3. CCK-8 analysis after culture for 1, 4, or 7 days o"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
137	15	5	paragraph_title	ALP activity and osteogenesis-related gene expression	[175.0, 1132.0, 656.0, 1157.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: ALP activity and osteogenesis-related gene expression"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
138	15	6	text	ALP activity and ALP staining were used to assess the osteogenic differentiation of rADSCs in the four groups after 14 days of culture. As shown in Figure 4., the ALP activity of the $ \beta $-TCP+PE	[173.0, 1194.0, 1018.0, 1472.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
139	15	7	footer	ACS Paragon Plus Environment	[463.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
140	16	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59	[8.0, 94.0, 44.0, 1514.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
141	16	1	number	Page 15 of 36	[12.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
142	16	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
143	16	3	chart		[198.0, 181.0, 995.0, 648.0]	figure_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
144	16	4	figure_title	Figure 4. ALP activity analysis of rADSCs after culture in osteogenic induction medium for 14 days. The activity of ALP in the TCPS+PEMF and $ \beta $-TCP groups was similar, and a significant differ	[173.0, 693.0, 1017.0, 973.0]	figure_caption	0.92	["figure_title label: Figure 4. ALP activity analysis of rADSCs after culture in o"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
145	16	5	text	Areas of positive ALP staining are shown as purple. As seen from Figure 5a and 5c, the positive area of the TCPS+PEMF group is more disperse than that of the TCPS group, and the coloration is deeper.	[174.0, 1070.0, 1016.0, 1344.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
146	16	6	footer	ACS Paragon Plus Environment	[463.0, 1601.0, 727.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
147	17	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[8.0, 83.0, 44.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
148	17	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 765.0, 46.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
149	17	2	number	Page 16 of 36	[1059.0, 18.0, 1179.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
150	17	3	image		[190.0, 158.0, 661.0, 398.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
151	17	4	image		[673.0, 156.0, 1012.0, 396.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
152	17	5	image		[323.0, 408.0, 662.0, 652.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
153	17	6	image		[672.0, 409.0, 1011.0, 650.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
154	17	7	figure_title	β-TCP	[348.0, 688.0, 421.0, 720.0]	figure_caption_candidate	0.85	["figure_title label: \u03b2-TCP"]	figure_caption	0.85	body_zone	unknown_like	short_fragment	False	False
155	17	8	figure_title	β-TCP+PEMF	[742.0, 687.0, 890.0, 720.0]	figure_caption	0.85	["figure_title label: \u03b2-TCP+PEMF"]	figure_caption	0.85	body_zone	unknown_like	short_fragment	True	True
156	17	9	image		[179.0, 751.0, 593.0, 1158.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
157	17	10	image		[610.0, 750.0, 1011.0, 1157.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
158	17	11	figure_title	Figure 5. ALP staining of rADSCs after culture in osteogenic induction medium for 14 days. (a), (b) rADSCs exposed to PEMF and cultured on TCPS. (c), (d) rADSCs not exposed to PEMF and cultured on TCP	[172.0, 1192.0, 1016.0, 1408.0]	figure_caption	0.92	["figure_title label: Figure 5. ALP staining of rADSCs after culture in osteogenic"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
159	17	12	text	qRT-PCR was performed to detect the expression of osteoblast-related genes in cells. As	[216.0, 1504.0, 1016.0, 1534.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
160	17	13	footer	ACS Paragon Plus Environment	[462.0, 1600.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
161	18	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 90.0, 42.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
162	18	1	number	Page 17 of 36	[12.0, 18.0, 130.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
163	18	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
164	18	3	text	shown in Figure 6a, the mean values of ALP and Runx2 expression were the highest in the $ \beta $-TCP+PEMF group after 7 days of culture, and there were significant differences among the groups. Ther	[174.0, 166.0, 1017.0, 503.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
165	18	4	text	On the 14th day (Figure 6b.), the expression of ALP, Runx2 and OPN was highest in the $ \beta $-TCP+PEMF group and was significantly higher than that in the other three groups. The expression of OPN	[174.0, 540.0, 1016.0, 753.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
166	18	5	text	On the 21st day (Figure 6c.), the expression of ALP, Runx2 and OPN in the $ \beta $-TCP+PEMF group was significantly higher than that in the other three groups, and the expression of ALP and Runx2 in	[174.0, 788.0, 1016.0, 1004.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
167	18	6	text	The ALP activity assay showed that the ALP activity of the cells treated with PEMF was significantly increased, and the ALP activity of the cells treated with PEMF was similar to that of the cells tre	[173.0, 1039.0, 1016.0, 1252.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
168	18	7	text	A study by LeGeros, R $ Z^{32} $ et al. showed that calcium phosphate compounds have the following characteristics: similarity to the composition of bone minerals, ability to form a unique bone-calci	[174.0, 1289.0, 1016.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
169	18	8	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
170	19	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[10.0, 84.0, 41.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
171	19	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
172	19	2	number	Page 18 of 36	[1059.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
173	19	3	text	mechanism by which PEMFs can promote osteogenic differentiation is not completely clear. Wang et al. showed that PEMFs could stimulate osteoblast differentiation by stimulating the sAC-cAMP-PKA-CREB s	[174.0, 165.0, 1017.0, 754.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
174	19	4	figure_title	ALP	[393.0, 796.0, 440.0, 822.0]	figure_caption	0.85	["figure_title label: ALP"]	figure_caption	0.85	body_zone	unknown_like	short_fragment	True	True
175	19	5	chart		[196.0, 824.0, 587.0, 1134.0]	media_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
176	19	6	figure_title	Runx2	[788.0, 796.0, 860.0, 823.0]	figure_caption_candidate	0.85	["figure_title label: Runx2"]	figure_caption	0.85	body_zone	unknown_like	short_fragment	False	False
177	19	7	chart		[610.0, 828.0, 993.0, 1133.0]	media_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
178	19	8	figure_title	OPN	[401.0, 1160.0, 451.0, 1187.0]	figure_caption	0.85	["figure_title label: OPN"]	figure_caption	0.85	body_zone	unknown_like	short_fragment	True	True
179	19	9	chart		[196.0, 1187.0, 907.0, 1497.0]	figure_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
180	19	10	footer	ACS Paragon Plus Environment	[463.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
181	20	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 89.0, 44.0, 1529.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
182	20	1	number	Page 19 of 36	[13.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
183	20	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
184	20	3	figure_title	Figure 6. qRT-PCR analysis was used to evaluate the expression of osteogenesis-related genes in rADSCs cultured in osteogenic induction medium for 7, 14 or 21 days. (a) The expression of ALPin the $	[173.0, 165.0, 1017.0, 817.0]	figure_caption	0.92	["figure_title label: Figure 6. qRT-PCR analysis was used to evaluate the expressi"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
185	20	4	paragraph_title	Micro CT scanning and hematoxylin-eosin staining	[175.0, 913.0, 621.0, 938.0]	subsection_heading	0.6	["unnumbered paragraph_title, inferred level subsection_heading: Micro CT scanning and hematoxylin-eosin staining"]	subsection_heading	0.6	body_zone	heading_like	none	True	True
186	20	5	text	As shown in Figure 7, the bone defect site of the SD rats not treated with PEMF, especially the side without the scaffold, grew slowly and new bone appeared at the edge of the defect site at the eight	[173.0, 978.0, 1016.0, 1441.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
187	20	6	text	Osteogenic differentiation and angiogenesis are essential for bone regeneration. In addition	[216.0, 1474.0, 1014.0, 1501.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
188	20	7	footer	ACS Paragon Plus Environment	[463.0, 1601.0, 727.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
189	21	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[10.0, 85.0, 41.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
190	21	1	header	ACS Biomaterials Science & Engineering	[425.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
191	21	2	number	Page 20 of 36	[1059.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
192	21	3	text	to promoting the osteogenic differentiation of stem cells, PEMF therapy can also promote angiogenesis. Yen-Patton, G P $ ^{43} $ et al. used PEMFs to treat endothelial cells of the human umbilical vei	[174.0, 165.0, 1017.0, 567.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
193	21	4	footer	ACS Paragon Plus Environment	[463.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
194	22	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[8.0, 87.0, 45.0, 1528.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
195	22	1	number	Page 21 of 36	[11.0, 17.0, 132.0, 45.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
196	22	2	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
197	22	3	image		[178.0, 154.0, 1011.0, 1130.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
198	22	4	figure_title	Figure 7. 3D reconstruction of the imaging data of SD rats after 0, 4, 8 and 12 weeks of rearing. The rats in the PEMF group were treated with PEMFs for 2 hours per day, whereas the rats in the withou	[173.0, 1161.0, 1015.0, 1315.0]	figure_caption	0.92	["figure_title label: Figure 7. 3D reconstruction of the imaging data of SD rats a"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
199	22	5	text	Bone mineral density (BMD) measurements of the new bone were determined in SD rats after 12 weeks. As shown in Figure 8, the highest BMD values were found in the cranial defects	[172.0, 1412.0, 1017.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
200	22	6	footer	ACS Paragon Plus Environment	[461.0, 1600.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
201	23	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 84.0, 42.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
202	23	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
203	23	2	number	Page 22 of 36	[1059.0, 18.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
204	23	3	text	of rats treated with the scaffold and PEMFs. The cranial defect of rats with the scaffold but without PEMF treatment followed closely. The blank group, which did not receive any treatments, had the lo	[174.0, 164.0, 1016.0, 317.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
205	23	4	chart		[208.0, 370.0, 988.0, 986.0]	figure_asset	0.85	["media label: chart"]	media_asset	0.85	body_zone	unknown_like	empty	True	True
206	23	5	figure_title	Figure 8. Bone mineral density analysis based on micro-CT data was used to detect the growth of skull defects in SD rats after 12 weeks of rearing. The BMD values of the defect site of rats in the $	[173.0, 1038.0, 1016.0, 1314.0]	figure_caption	0.92	["figure_title label: Figure 8. Bone mineral density analysis based on micro-CT da"]	figure_caption	0.92	display_zone	legend_like	figure_number	True	True
207	23	6	text	The results of the HE staining (Figure 9) showed that the implanted scaffold defects possessed good bone mass; however, the rats treated with PEMFs grew thicker bone tissue than	[173.0, 1412.0, 1016.0, 1502.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
208	23	7	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
209	24	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 91.0, 44.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
210	24	1	number	Page 23 of 36	[12.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
211	24	2	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
212	24	3	text	the rats who had not been treated with PEMFs. In the defect sites without $ \beta $-TCP scaffold implantation, the amount of new bone tissue was reduced, and the new bone tissue structure was more di	[173.0, 164.0, 1016.0, 380.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
213	24	4	text	The BMD results of this study indicate that the BMD values of the defect sites of the rats treated with PEMFs were higher than those of the rats who did not receive PEMF treatment, regardless of wheth	[174.0, 415.0, 1017.0, 878.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6	body_zone	body_like	none	True	True
214	24	5	footer	ACS Paragon Plus Environment	[463.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	body_zone	body_like	none	False	False
215	25	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 84.0, 42.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
216	25	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
217	25	2	number	Page 24 of 36	[1059.0, 18.0, 1178.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	short_fragment	False	False
218	25	3	image		[178.0, 154.0, 1010.0, 426.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
219	25	4	image		[179.0, 491.0, 1010.0, 766.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
220	25	5	image		[180.0, 829.0, 1009.0, 1107.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
221	25	6	image		[179.0, 1168.0, 1009.0, 1444.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
222	25	7	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
223	26	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 91.0, 41.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
224	26	1	number	Page 25 of 36	[12.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	short_fragment	False	False
225	26	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 763.0, 45.0]	noise	0.9	["header label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
226	26	3	image		[180.0, 146.0, 1010.0, 770.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
227	26	4	image		[180.0, 858.0, 1009.0, 1478.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
228	26	5	footer	ACS Paragon Plus Environment	[463.0, 1600.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
229	27	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 84.0, 44.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95		reference_like	reference_numeric_dot	False	False
230	27	1	header	ACS Biomaterials Science & Engineering	[425.0, 17.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
231	27	2	number	Page 26 of 36	[1059.0, 18.0, 1178.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	short_fragment	False	False
232	27	3	image		[180.0, 145.0, 1010.0, 770.0]	media_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
233	27	4	image		[179.0, 856.0, 1010.0, 1479.0]	figure_asset	0.85	["media label: image"]	media_asset	0.85	tail_nonref_hold_zone	unknown_like	empty	True	True
234	27	5	figure_title	Figure 9. HE staining of the cranial defects of rats after 12 weeks of rearing. (A), (E) Rats	[173.0, 1504.0, 1014.0, 1532.0]	figure_caption	0.92	["figure_title label: Figure 9. HE staining of the cranial defects of rats after 1"]	figure_caption	0.92	tail_nonref_hold_zone	legend_like	figure_number	True	True
235	27	6	footer	ACS Paragon Plus Environment	[461.0, 1600.0, 729.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
236	28	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 90.0, 44.0, 1530.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
237	28	1	number	Page 27 of 36	[12.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9	body_zone	body_like	short_fragment	False	False
238	28	2	header	ACS Biomaterials Science & Engineering	[426.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9	body_zone	body_like	none	False	False
239	28	3	text	implanted with a $ \beta $-TCP scaffold and exposed to PEMFs. (B), (F) Rats implanted with a $ \beta $-TCP scaffold and not exposed to PEMFs. (C), (G) Rats exposed to PEMFs. (D), (H) Rats not expose	[175.0, 163.0, 1017.0, 314.0]	body_paragraph	0.6	["default body_paragraph for text label", "promoted in tail spread from body_paragraph"]	body_paragraph	0.6	body_zone	body_like	none	True	True
240	28	4	paragraph_title	CONCLUSION	[176.0, 475.0, 301.0, 500.0]	section_heading	0.9	["explicit scholarly heading: CONCLUSION"]	section_heading	0.9	body_zone	heading_like	canonical_section_name	True	True
241	28	5	text	To summarize, 3D-printed $ \beta $-TCP porous scaffolds have excellent performance in the treatment of skull defects in rats. These scaffolds solve the problems associated with complications and limi	[173.0, 541.0, 1018.0, 1253.0]	body_paragraph	0.6	["default body_paragraph for text label", "promoted in tail spread from body_paragraph"]	body_paragraph	0.6	body_zone	body_like	none	True	True
242	28	6	paragraph_title	REFERENCES	[176.0, 1411.0, 293.0, 1437.0]	reference_heading	0.9	["references heading: REFERENCES"]	reference_heading	0.9	reference_zone	heading_like	short_fragment	True	True
243	28	7	reference_content	(1) Bassett, C. A.; Pawluk, R. J.; Pilla, A. A., Acceleration of fracture repair by electromagnetic	[187.0, 1474.0, 1014.0, 1500.0]	reference_item	0.85	["reference content label: (1) Bassett, C. A.; Pawluk, R. J.; Pilla, A. A., Acceleratio"]	reference_item	0.85	reference_zone	reference_like	reference_numeric_parenthesis	True	True
244	28	8	footer	ACS Paragon Plus Environment	[462.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9	tail_nonref_hold_zone	unknown_like	none	False	False
245	29	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 91.0, 41.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
246	29	1	header	ACS Biomaterials Science & Engineering	[425.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
247	29	2	number	Page 28 of 36	[1060.0, 19.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
248	29	3	text	fields. A surgically noninvasive method. Ann N Y Acad Sci 1974, 238, 242-62	[176.0, 164.0, 826.0, 189.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		unknown_like	none	True	True
249	29	4	text	(2) Bassett, C. A.; Mitchell, S. N.; Gaston, S. R., Treatment of ununited tibial diaphyseal fractures with pulsing electromagnetic fields. J BONE JOINT SURG AM 1981, 63, (4), 511-23	[176.0, 228.0, 1014.0, 316.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
250	29	5	text	(3) Ryaby, J. T., Clinical effects of electromagnetic and electric fields on fracture healing. Clin Orthop Relat Res 1998, (355 Suppl), S205-15	[176.0, 351.0, 1014.0, 439.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
251	29	6	text	(4) Adie, S.; Harris, I. A.; Naylor, J. M.; Rae, H.; Dao, A.; Yong, S.; Ying, V., Pulsed electromagnetic field stimulation for acute tibial shaft fractures: a multicenter, double-blind, randomized tri	[175.0, 476.0, 1016.0, 626.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
252	29	7	text	(5) Prakash, D.; Behari, J., Synergistic role of hydroxyapatite nanoparticles and pulsed electromagnetic field therapy to prevent bone loss in rats following exposure to simulated microgravity. Int J	[175.0, 664.0, 1015.0, 814.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
253	29	8	text	(6) Thamsborg, G.;Florescu, A.;Oturai, P.;Fallentin, E.;Tritsaris, K.;Dissing, S., Treatment of knee osteoarthritis with pulsed electromagnetic fields: a randomized, double-blind, placebo-controlled s	[175.0, 851.0, 1014.0, 1065.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
254	29	9	text	(7) Ryang, W. S.; Koog, Y. H.; Jeong, K. I.; Wi, H., Effects of pulsed electromagnetic field on knee osteoarthritis: a systematic review. Rheumatology (Oxford) 2013, 52, (5), 815-24. DOI:10.1093/rheum	[175.0, 1101.0, 1014.0, 1250.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
255	29	10	text	(8) Bagnato, G. L.; Miceli, G.; Marino, N.; Sciortino, D.; Bagnato, G. F., Pulsed electromagnetic fields in knee osteoarthritis: a double blind, placebo-controlled, randomized clinical trial. Rheumato	[175.0, 1288.0, 1014.0, 1440.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
256	29	11	text	(9) Barker, A. T.; Dixon, R. A.; Sharrard, W. J.; Sutcliffe, M. L., Pulsed magnetic field therapy for	[186.0, 1474.0, 1015.0, 1500.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
257	29	12	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
258	30	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 92.0, 41.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
259	30	1	number	Page 29 of 36	[13.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
260	30	2	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 44.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
261	30	3	text	tibial non-union. Interim results of a double-blind trial. LANCET 1984, 1, (8384), 994-6 (10) de Haas, W. G.;Beaupre, A.;Cameron, H.;English, E., The Canadian experience with pulsed magnetic fields in	[175.0, 166.0, 1014.0, 374.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		body_like	none	True	True
262	30	4	text	(11) Khooshideh, M.; Latifi, R. S.; Sheikh, M.; Ghorbani, Y. B.; Shahriari, A., Pulsed Electromagnetic Fields for Postsurgical Pain Management in Women Undergoing Cesarean Section: A Randomized, Doubl	[176.0, 415.0, 1015.0, 625.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
263	30	5	text	(12) Varani, K.; Vincenzi, F.; Ravani, A.; Pasquini, S.; Merighi, S.; Gessi, S.; Setti, S.; Cadossi, M.; Borea, P. A.; Cadossi, R., Adenosine Receptors as a Biological Pathway for the Anti-Inflammator	[174.0, 665.0, 1016.0, 876.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
264	30	6	text	(13) Martiny, K.; Lunde, M.; Bech, P., Transcranial low voltage pulsed electromagnetic fields in patients with treatment-resistant depression. Biol Psychiatry 2010, 68, (2), 163-9. DOI:10.1016/j.biops	[175.0, 914.0, 1014.0, 1063.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
265	30	7	text	(14) van Belkum, S. M.; Bosker, F. J.; Kortekaas, R.; Beersma, D. G.; Schoevers, R. A., Treatment of depression with low-strength transcranial pulsed electromagnetic fields: A mechanistic point of vie	[176.0, 1102.0, 1015.0, 1314.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
266	30	8	text	(15) Rezaei, K. M.; Tabeie, F.; Sahebjam, F.; Poursani, N.; Jahanbakhsh, N.; Paymanpour, P.; AfsarAski, S., Short-term effects of extremely low-frequency pulsed electromagnetic field and pulsed low-le	[175.0, 1351.0, 1015.0, 1501.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
267	30	9	footer	ACS Paragon Plus Environment	[462.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
268	31	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 92.0, 41.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
269	31	1	header	ACS Biomaterials Science & Engineering	[425.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
270	31	2	number	Page 30 of 36	[1060.0, 19.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
271	31	3	text	216-223.DOI:10.1016/j.exer.2016.01.007	[177.0, 164.0, 533.0, 187.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		unknown_like	none	True	True
272	31	4	text	(16) Pena-Philippides, J. C.; Yang, Y.; Bragina, O.; Hagberg, S.; Nemoto, E.; Roitbak, T., Effect of pulsed electromagnetic field (PEMF) on infarct size and inflammation after cerebral ischemia in mic	[175.0, 228.0, 1015.0, 378.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
273	31	5	text	(17) Leoci, R.; Aiudi, G.; Silvestre, F.; Lissner, E.; Lacalandra, G. M., Effect of pulsed electromagnetic field therapy on prostate volume and vascularity in the treatment of benign prostatic hyperpl	[175.0, 415.0, 1015.0, 626.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
274	31	6	text	(18) Wang, Y. Y.; Pu, X. Y.; Shi, W. G.; Fang, Q. Q.; Chen, X. R.; Xi, H. R.; Gao, Y. H.; Zhou, J.; Xian, C. J.; Chen, K. M., Pulsed electromagnetic fields promote bone formation by activating the sAC	[174.0, 665.0, 1014.0, 876.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
275	31	7	text	(19) Poh, P.; Seeliger, C.; Unger, M.; Falldorf, K.; Balmayor, E. R.; van Griensven, M., Osteogenic Effect and Cell Signaling Activation of Extremely Low-Frequency Pulsed Electromagnetic Fields in Adi	[175.0, 914.0, 1014.0, 1127.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
276	31	8	text	(20) Bagheri, L.; Pellati, A.; Rizzo, P.; Aquila, G.; Massari, L.; De Mattei, M.; Ongaro, A., Notch pathway is active during osteogenic differentiation of human bone marrow mesenchymal stem cells indu	[175.0, 1164.0, 1014.0, 1375.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
277	31	9	text	(21) Selvamurugan, N.; He, Z.; Rifkin, D.; Dabovic, B.; Partridge, N. C., Pulsed Electromagnetic Field Regulates MicroRNA 21 Expression to Activate TGF-beta Signaling in Human Bone Marrow	[175.0, 1413.0, 1014.0, 1500.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
278	31	10	footer	ACS Paragon Plus Environment	[462.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
279	32	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 92.0, 41.0, 1531.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
280	32	1	number	Page 31 of 36	[12.0, 18.0, 130.0, 44.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
281	32	2	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
282	32	3	text	Stromal Cells to Enhance Osteoblast Differentiation. STEM CELLS INT 2017, 2017, 2450327\.DOI:10\.1155/2017/2450327	[174.0, 164.0, 1015.0, 251.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		body_like	none	True	True
283	32	4	text	(22) Xie, Y. F.; Shi, W. G.; Zhou, J.; Gao, Y. H.; Li, S. F.; Fang, Q. Q.; Wang, M. G.; Ma, H. P.; Wang, J. F.; Xian, C. J.; Chen, K. M., Pulsed electromagnetic fields stimulate osteogenic differentia	[174.0, 290.0, 1016.0, 502.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
284	32	5	text	(23) Yin, Y.; Chen, P.; Yu, Q.; Peng, Y.; Zhu, Z.; Tian, J., The Effects of a Pulsed Electromagnetic Field on the Proliferation and Osteogenic Differentiation of Human Adipose-Derived Stem Cells. Med	[175.0, 539.0, 1016.0, 689.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
285	32	6	text	(24) Hollister, S. J., Porous scaffold design for tissue engineering. NAT MATER 2005, 4, (7), 518-24. DOI:10.1038/nmat1421	[175.0, 726.0, 1013.0, 812.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
286	32	7	text	(25) Verrier, S.;Alini, M.;Alsberg, E.;Buchman, S. R.;Kelly, D.;Laschke, M. W.;Menger, M. D.;Murphy, W. L.;Stegemann, J. P.;Schutz, M.;Miclau, T.;Stoddart, M. J.;Evans, C., Tissue engineering and rege	[174.0, 852.0, 1016.0, 1064.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
287	32	8	text	(26) Matinfar, M.;Mesgar, A. S.;Mohammadi, Z., Evaluation of physicochemical, mechanical and biological properties of chitosan/carboxymethyl cellulose reinforced with multiphasic calcium phosphate whi	[175.0, 1102.0, 1014.0, 1314.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
288	32	9	text	(27) Dasgupta, S.; Maji, K.; Nandi, S. K., Investigating the mechanical, physiochemical and osteogenic properties in gelatin-chitosan-bioactive nanoceramic composite scaffolds for bone tissue regenera	[175.0, 1350.0, 1015.0, 1501.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
289	32	10	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
290	33	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 91.0, 41.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
291	33	1	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
292	33	2	number	Page 32 of 36	[1060.0, 19.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
293	33	3	text	713-728.DOI:10.1016/j.msec.2018.10.022	[177.0, 164.0, 540.0, 188.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		unknown_like	none	True	True
294	33	4	text	(28) Mathieu, L. M.; Mueller, T. L.; Bourban, P. E.; Pioletti, D. P.; Muller, R.; Manson, J. A., Architecture and properties of anisotropic polymer composite scaffolds for bone tissue engineering. BIO	[176.0, 228.0, 1015.0, 379.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
295	33	5	text	(29) Park, H. J.; Lee, O. J.; Lee, M. C.; Moon, B. M.; Ju, H. W.; Lee, J.; Kim, J. H.; Kim, D. W.; Park, C. H., Fabrication of 3D porous silk scaffolds by particulate (salt/sucrose) leaching for bone	[176.0, 414.0, 1016.0, 564.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
296	33	6	text	(30) Ma, H.; Feng, C.; Chang, J.; Wu, C., 3D-printed bioceramic scaffolds: From bone tissue engineering to tumor therapy. ACTA BIOMATER 2018, 79, 37-59.DOI:10.1016/j.actbio.2018.08.026	[176.0, 601.0, 1015.0, 751.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
297	33	7	text	(31) Samavedi, S.; Whittington, A. R.; Goldstein, A. S., Calcium phosphate ceramics in bone tissue engineering: a review of properties and their influence on cell behavior. ACTA BIOMATER 2013, 9, (9),	[175.0, 788.0, 1014.0, 938.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
298	33	8	text	(32) LeGeros, R. Z., Properties of osteoconductive biomaterials: calcium phosphates. Clin Orthop Relat Res 2002, (395), 81-98	[176.0, 976.0, 1014.0, 1063.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
299	33	9	text	(33) Zou, F.;Zhao, N.;Fu, X.;Diao, J.;Ma, Y.;Cao, X.;Wan, S.;Zhong, S.;Wang, Y., Enhanced osteogenic differentiation and biomineralization in mouse mesenchymal stromal cells on a beta-TCP robocast sca	[176.0, 1102.0, 1015.0, 1313.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
300	33	10	text	(34) Jarcho, M., Calcium phosphate ceramics as hard tissue prosthetics. Clin Orthop Relat Res 1981, (157), 259-78	[177.0, 1350.0, 1013.0, 1437.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
301	33	11	text	(35) Zhang, Y.;Xia, L.;Zhai, D.;Shi, M.;Luo, Y.;Feng, C.;Fang, B.;Yin, J.;Chang, J.;Wu, C., Mesoporous	[178.0, 1475.0, 1014.0, 1500.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
302	33	12	footer	ACS Paragon Plus Environment	[462.0, 1602.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
303	34	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 92.0, 41.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
304	34	1	number	Page 33 of 36	[13.0, 18.0, 131.0, 44.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
305	34	2	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
306	34	3	text	bioactive glass nanolayer-functionalized 3D-printed scaffolds for accelerating osteogenesis and angiogenesis. NANOSCALE 2015, 7, (45), 19207-21. DOI:10.1039/c5nr05421d	[175.0, 165.0, 1013.0, 253.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		body_like	none	True	True
307	34	4	text	(36) Bose, S.; Tarafder, S.; Bandyopadhyay, A., Effect of Chemistry on Osteogenesis and Angiogenesis Towards Bone Tissue Engineering Using 3D Printed Scaffolds. ANN BIOMED ENG 2017, 45, (1), 261-272.	[175.0, 289.0, 1015.0, 439.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
308	34	5	text	(37) Karageorgiou, V.; Kaplan, D., Porosity of 3D biomaterial scaffolds and osteogenesis. BIOMATERIALS 2005, 26, (27), 5474-91. DOI:10.1016/j.biomaterials.2005.02.002	[175.0, 476.0, 1012.0, 565.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
309	34	6	text	(38) Midura, R. J.; Ibiwoye, M. O.; Powell, K. A.; Sakai, Y.; Doehring, T.; Grabiner, M. D.; Patterson, T. E.; Zborowski, M.; Wolfman, A., Pulsed electromagnetic field treatments enhance the healing o	[175.0, 601.0, 1015.0, 752.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
310	34	7	text	(39) Parkinson, W. C.; Hanks, C. T., Search for cyclotron resonance in cells in vitro. BIOELECTROMAGNETICS 1989, 10, (2), 129-45	[175.0, 788.0, 1013.0, 875.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
311	34	8	text	(40) Liu, C.; Yu, J.; Yang, Y.; Tang, X.; Zhao, D.; Zhao, W.; Wu, H., Effect of 1 mT sinusoidal electromagnetic fields on proliferation and osteogenic differentiation of rat bone marrow mesenchymal st	[175.0, 914.0, 1015.0, 1128.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
312	34	9	text	(41) Tsai, M. T.; Chang, W. H.; Chang, K.; Hou, R. J.; Wu, T. W., Pulsed electromagnetic fields affect osteoblast proliferation and differentiation in bone tissue engineering. BIOELECTROMAGNETICS 2007	[175.0, 1164.0, 1015.0, 1313.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
313	34	10	text	(42) Wang, P.; Liu, J.; Yang, Y.; Zhai, M.; Shao, X.; Yan, Z.; Zhang, X.; Wu, Y.; Cao, L.; Sui, B.; Luo, E.; Jing, D. Differential intensity-dependent effects of pulsed electromagnetic fields on RANKL	[176.0, 1350.0, 1015.0, 1500.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
314	34	11	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
315	35	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[11.0, 93.0, 41.0, 1525.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
316	35	1	header	ACS Biomaterials Science & Engineering	[426.0, 19.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
317	35	2	number	Page 34 of 36	[1060.0, 19.0, 1178.0, 43.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
318	35	3	text	BIOELECTROMAGNETICS 2017, 38, (8), 602-612.DOI:10.1002/bem.22070	[176.0, 164.0, 802.0, 188.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		unknown_like	none	True	True
319	35	4	text	(43) Yen-Patton, G. P.; Patton, W. F.; Beer, D. M.; Jacobson, B. S., Endothelial cell response to pulsed electromagnetic fields: stimulation of growth rate and angiogenesis in vitro. J CELL PHYSIOL 19	[175.0, 228.0, 1015.0, 377.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
320	35	5	text	(44) Tepper, O. M.; Callaghan, M. J.; Chang, E. I.; Galiano, R. D.; Bhatt, K. A.; Baharestani, S.; Gan, J.; Simon, B.; Hopper, R. A.; Levine, J. P.; Gurtner, G. C., Electromagnetic fields increase in	[175.0, 415.0, 1014.0, 626.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
321	35	6	text	(45) Loh, Q. L.; Choong, C., Three-Dimensional Scaffolds for Tissue Engineering Applications: Role of Porosity and Pore Size. TISSUE ENGINEERING PART B-REVIEWS 2013, 19, (6), 485-502. DOI:10.1089/ten.	[175.0, 664.0, 1014.0, 812.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
322	35	7	text	(46) Koski, C.; Onuike, B.; Bandyopadhyay, A.; Bose, S., Starch-hydroxyapatite composite bone scaffold fabrication utilizing a slurry extrusion-based solid freeform fabricator. ADDITIVE MANUFACTURING	[175.0, 852.0, 1016.0, 1001.0]	reference_item	0.82	["default body_paragraph for text label", "late role resolution: reference_like family + reference zone", "style_family_authority=reference_marker", "context_source=block"]	body_paragraph	0.6	reference_zone	reference_like	reference_numeric_parenthesis	True	True
323	35	8	footer	ACS Paragon Plus Environment	[463.0, 1603.0, 728.0, 1626.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
324	36	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[8.0, 91.0, 44.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
325	36	1	number	Page 35 of 36	[12.0, 18.0, 132.0, 44.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
326	36	2	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 46.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
327	36	3	text	Table of Contents graphic	[480.0, 287.0, 712.0, 317.0]	table_caption_candidate	0.78	["default body_paragraph for text label", "late role resolution: non-body family 'table_caption_like' overrides body_paragraph", "style_family_authority=table_marker", "context_source=families"]	body_paragraph	0.6		table_caption_like	none	True	True
328	36	4	doc_title	3D-printed $ \beta $-tricalcium phosphate scaffold combined with a pulse electromagnetic field promotes the repair of skull defects in rats	[204.0, 349.0, 985.0, 441.0]	unknown_structural	0.2	["unrecognized label 'doc_title'"]	unknown_structural	0.2		unknown_like	none	False	True
329	36	5	text	Haifeng Liang, Xiao Liu, Ying Pi, Qiang Yu, Yukun Yin, Xian Li, Yipei Yang, Jing Tian	[245.0, 474.0, 946.0, 503.0]	frontmatter_noise	0.7	["keyword-like block: Haifeng Liang, Xiao Liu, Ying Pi, Qiang Yu, Yukun Yin, Xian "]	frontmatter_noise	0.7		unknown_like	none	False	False
330	36	6	image		[221.0, 554.0, 943.0, 884.0]	table_html	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
331	36	7	vision_footnote	Skull Defects Model in S-D Rat	[285.0, 814.0, 583.0, 879.0]	footnote	0.7	["vision_footnote label: Skull Defects Model in S-D Rat"]	footnote	0.7		unknown_like	none	True	True
332	36	8	vision_footnote	3D-Printed β-TCP Scaffold	[683.0, 816.0, 896.0, 883.0]	footnote	0.7	["vision_footnote label: 3D-Printed\n\u03b2-TCP Scaffold"]	footnote	0.7		unknown_like	none	True	True
333	36	9	image		[303.0, 938.0, 587.0, 1088.0]	media_asset	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
334	36	10	image		[617.0, 933.0, 860.0, 1094.0]	media_asset	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
335	36	11	vision_footnote	PEMF Generator	[351.0, 1100.0, 594.0, 1136.0]	footnote	0.7	["vision_footnote label: PEMF Generator"]	footnote	0.7		unknown_like	short_fragment	True	True
336	36	12	image		[634.0, 1102.0, 878.0, 1191.0]	media_asset	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
337	36	13	vision_footnote	20ms	[669.0, 1167.0, 729.0, 1190.0]	footnote	0.7	["vision_footnote label: 20ms"]	footnote	0.7		unknown_like	short_fragment	True	True
338	36	14	image		[269.0, 1224.0, 539.0, 1422.0]	media_asset	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
339	36	15	vision_footnote	The rat exposed to PEMF	[245.0, 1428.0, 577.0, 1460.0]	footnote	0.7	["vision_footnote label: The rat exposed to PEMF"]	footnote	0.7		unknown_like	none	True	True
340	36	16	image		[674.0, 1224.0, 925.0, 1425.0]	media_asset	0.85	["media label: image"]	media_asset	0.85		unknown_like	empty	True	True
341	36	17	vision_footnote	The rat not exposed to PEMF	[608.0, 1428.0, 994.0, 1460.0]	footnote	0.7	["vision_footnote label: The rat not exposed to PEMF"]	footnote	0.7		unknown_like	none	True	True
342	36	18	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False
343	37	0	aside_text	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60	[9.0, 86.0, 42.0, 1532.0]	noise	0.95	["margin-band narrow/tall geometry; treated as noise"]	noise	0.95	reference_zone	reference_like	reference_numeric_dot	False	False
344	37	1	header	ACS Biomaterials Science & Engineering	[425.0, 18.0, 764.0, 45.0]	noise	0.9	["header label"]	noise	0.9		unknown_like	none	False	False
345	37	2	number	Page 36 of 36	[1059.0, 18.0, 1178.0, 44.0]	noise	0.9	["page number label"]	noise	0.9		unknown_like	short_fragment	False	False
346	37	3	text	For Table of Contents Use Only	[456.0, 163.0, 735.0, 190.0]	body_paragraph	0.6	["default body_paragraph for text label"]	body_paragraph	0.6		unknown_like	none	True	True
347	37	4	footer	ACS Paragon Plus Environment	[462.0, 1601.0, 728.0, 1627.0]	noise	0.9	["footer label"]	noise	0.9		unknown_like	none	False	False